Browse Prior Art Database

A Prediction Algorithm, based on Genomic Comparison between all Life Kingdoms, and one Single Snake, base on snake levels will predict if any animal on earth will be Kosher According to the exact definition of the Jewish Bible. Disclosure Number: IPCOM000241043D
Publication Date: 2015-Mar-22

Publishing Venue

The Prior Art Database


According to the Jewish Bible, 3 different life Kingdoms Have Completely different specifications for; if an animal can be eaten - 'Kosher", or "Not Kosher" - Can not be eaten. The 3 Main Departments are: 1. Mammals 2. Birds 3. Fishes For each of the 3 Life Kingdom, a different Specification Exist. 1. For Mammals. she must be a rumination, With Split Hoofs 2. For Birds, all birds are allowed, except a defined list of Birds that are not 3. On the fish departments the fish must have scales, and must have a tail The Jewish bible, defines evolution theory in a different way The Bible perspective is that the creation started as perfect. And One Single Ancestor Snake have damaged all the creation, In all levels of life. And basically in all life Kingdoms The Jewish scripts reveal that the ancestor snake Have transferred genetic material into the humans, The assumption is that the material exist in all life kingdoms And all the creation have downgraded immediately In several stages. the initial dna transfer. This immediately created distinct hybrids in the creation The Ancestor snake is than deformed into a downgraded version of what he was, which is the snake in his form today However, most of the genetic material of the ancestor snake is available in the genome, it was just deactivated in the genome For Example, According to the Bible, he had Legs and Arms, According to Science, His dna contains most of the genomic sectors for arms and legs This approach have lead the line of thinking, to check how much snake we have inside different creatures And found that base on the levels and the amount, you get a direct match on all kosher animal defined In the Bible While the Quail will present the lowest levels in all creation and he is Kosher All other Kosher Animals are an opposite to the quail, and will be kosher as well Presenting only animals that are very highly correlated to the snake genome. The reason for this system, is allowing them to be eaten, is because, they need to go throw a genomic Correction process. Which is spiritual, and physical But to simplify the issue, if an animal is very correlated to the snake, she will be Kosher The Bible provided parameter for the criteria as the Quail. So we will get a perspective how a clean animal genome acts. And from that point we will set our Predictor, to locate anything above this level, and Measure it The Genomic Engine, does not need to get any additional information except the Snake Genome, and the Animal Tested The Genomic Predictor will predict: 1. If Animal is Kosher or Not on all 3 Kingdoms Base on Snake Only 2. Even in a sample that will include any creature on earth, the Predictor will always find, The Cow and the Quail. The Most clean and the Most Damaged The Engine Work Flow The Engine Objective is to know exactly how many identical dna units in a defined length Will be found from the snake inside the animal tested For this task, I have defined a length of dna string in the size of 22 Basic Pairs 22 Basic pairs create a combination in the size of 17,592,186,044,416 (2 Power 44) It creates a dna key, in the proper size, not to exist by chance in 2 genomes by chance. However, the problem is that inside the genome of every creature, some combinations are very common And those common units repeats a lot all over the creation genome The reason for this is that those are not dna code, they are dna Data for other dna code that will Execute them. Since on those we cannot understand the bigger picture, we would like to eliminate them And stay with the code part that we are sure is a very unique code units In order to get those out of our way, we use a very simple procedure. That will score the 22 letters key Into 1 of 3 results BAD KEY,GOOD RANDOM KEY, SUPERIAR KEY RANDOM AND ALL 4 DNA LETTERS A,C,T,G Are Included For Example: ATATATATA or CTGCTGCTG, we want any thing we can have some understanding in, to get out of the way Simply, because if we do get some understanding, it means we did not understand nothing. as we do not see the big picture of this data processing It can be a production of keratin according to a shape, While in one it can be a small Nail, and in someone else it can be a turtle back The Algorithm will be set to Run all over the Genome, while breaking it into Units in the Length of 30 Million Basic Paris So for Example, in an average bird, we have 1Billion BP, she will have about 33 tests, that will cover all her genome Each Sector in the length of 30 Million Basic Pairs, will be compared Against the Full Snake 1.6 Billion Basic Pairs Genome The objecting is as follows: to tun from beginning to end of the Snake Genome, and move only one step in each move In Each Step, Get 22 Dna Basic Pairs from where you are standing forward. And move one forward, continue doing so until you went all over the length of the Dna of The Snake While for 22 Letters Score them first against the Randomness Scoring System If the Key score is 0, move to the next key and do nothing If the key score 1 or 2, do the following Scan all the 30,000,000 Basic Pairs of the Animal Tested, for Example, Chicken And see if this key exist in the Chicken all over her Genome For Each location where a match was found, count the number of matches found in the Test Animal We will keep things as simple as possible, and will use the minimal needs, to predict for Kosher or Not Kosher Write into Sql Server Database, how many times the key Exist in the Chicken And how many times it exist in the Snake: So for example: ACTTGATGGAACTGAAATGCC 10 In Snake, 2 in Chicken For Each Location in the chicken write into another SQL Server Table the Position of the match in the chicken For Example: ACTTGATGGAACTGAAATGCC , Position 127836221 ACTTGATGGAACTGAAATGCC , Position 432412324 The Analysis: In Each sector Each Key must pass a criteria The Criteria used in our case is 20 Repeats of the Key in the Animal you wish to know if she is kosher If the Key has scored more than 20 In this sector, he passes a First test, And will be counted as a Valid Hit in One Single Sector Than take all the sectors together, and check how many times the key hit in total, and in how many sectors Final Multi Sector Analysis will return something like this DNA KEY: Chicken Snake Sectors AAGATCATCTAGTCCAATCCCC ,2794, 1, 37 AGATCATCTAGTCCAATCCCCC ,2699, 2, 37 ATCATCTAGTCCAATCCCCCTG ,2526, 1, 37 GATCATCTAGTCCAATCCCCCT ,2519, 1, 37 CTCTCTCCAGCAGTTCCCTGTC ,2510, 1, 37 GCAGGGGGATTGGACTAGATGA ,2494, 4, 37 Now, On the Mammals Kingdom, a prediction is simple, anything in the millions is a kosher Mammal The highest level in creation will be the Cow: So doing the above process to all creation will mark the Cow, as the Highest and the Quail as the Lowest Please note: Cow, is Kosher, and the Number 1 Elevated Korban in the Temple Next, Goat Sheep’s, Antelope, deer.. will all be found kosher, with Millions of repeats Moving to Aves Department: Anything over 8000 will be kosher Sea Department: Anything above 10000 will be kosher Conclusion: How is this possible that a book called the Bible knew to tell us what to eat and what not to eact base On how much snake Genome Exist inside an Animal DNA In 3 Different Animal Kingdom completely, In the Earth, in the Sky, and in the Water While for each department she provided a completely different type of signs Who knew thousands of years ago How Much Snake Dna Exist in Every Animal on Earth?

This text was extracted from a PDF file.
This is the abbreviated version, containing approximately 7% of the total text.

Page 01 of 208

According to the Jewish Bible, 3 different life Kingdoms

Have Completely different specifications for; if an animal can be eaten - 'Kosher", or "Not Kosher" - Can not be eaten.

The 3 Main Departments are:
1. Mammals

2. Birds

3. Fishes

For each of the 3 Life Kingdom, a different Specification Exist.

1. For Mammals. she must be a rumination, With Split Hoofs

2. For Birds, all birds are allowed, except a defined list of Birds that are not

This defined group, contain all Predators, Crow, Owl, and others

In our days some of the birds are unknowns, and some information was lost during the years However, there is 100% an agreement of the following as Kosher Birds:

1. Chicken

2. Turkey

3. Pepion

4. Duck

5. Quail

Quail, is an exception, as he is defined as specific bird, given to the Jewish people while in the desert. And he should be the best choice in that department.

It is the only meat form chosen by god as defined in the Bible. And there for should present the highest exception

To all creation forms damage levels of the snake.

Page 02 of 208

3. On the fish departments the fish must have scales, and must have a tail

The Jewish bible, defines evolution theory in a different way

The Bible perspective is that the creation started as perfect. And One Single Ancestor Snake have damaged all the creation, In all levels of life. And basically in all life Kingdoms

The Jewish scripts reveal that the ancestor snake

Have transferred genetic material into the humans,

The assumption is that the material exist in all life kingdoms And all the creation have downgraded immediately

In several stages. the initial dna transfer.

This immediately created distinct hybrids in the creation

The Ancestor snake is than deformed into a downgraded version of what he was, which is the snake in his form today

However, most of the genetic material of the ancestor snake is available in the genome, it was just deactivated in the genome

For Example, According to the Bible, he had Legs and Arms, According to Science, His dna contains most of the genomic sectors for arms and legs

This approach have lead the line of thinking, to check how much snake we have inside different creatures

And found that base on the levels and the amount, you get a direct match on all kosher animal defined In the Bible

While the Quail will present the lowest levels in all creation and he is Kosher

Page 03 of 208

All other Kosher Animals are an opposite to the quail, and will be kosher as well Presenting only animals that are very highly correlated to the snake genome.

The reason for this system, is allowing them to be eaten, is because, they need to go throw a genomic Correction process. Which is spiritual, and physical

But to simplify the issue, if an animal is very correlated to the snake, she will be Kosher

The Bible provided parameter for the criteria as the Quail.

So we will get a perspective how a clean animal genome acts.

And from that point we will set our Predictor, to locate anything...