Browse Prior Art Database

Soybean Trait Polymorphisms and Sequences to Detect Them

IP.com Disclosure Number: IPCOM000242864D
Publication Date: 2015-Aug-26
Document File: 10 page(s) / 74K

Publishing Venue

The IP.com Prior Art Database

Abstract

There has been much progress in molecular marker and bioinformatics technologies for crop development that have increased the quality, availability, and density of trait markers. Molecular markers associated with traits provide breeders additional tools and opportunities to more quickly and reliably produce genetically improved varieties with important traits and/or trait packages. Described herein are polymorphisms associated with traits in soybean, their region of the Glycine max genome, as well as exemplary primers and probes that can be used for detection using, for example, TAQMAN® systems. The physical map locations are based on the Glyma1.0 genome sequence physical map for Glycine max (Schmutz et al. (2010) Nature 463:178-183; available from phytozome.net/soybean), and any genetic map locations are based on the soybean genetic consensus map version 4.0 (Hyten et al. (2010) Crop Science 50:960-968). Alternate primer and probe designs are within the expertise of one of skill in the art. Allele calls are provided as phenotype1/phenotype2.

This text was extracted from a PDF file.
This is the abbreviated version, containing approximately 22% of the total text.

Page 01 of 10

Soyxean Trait Polymorphisms and Sequences to Detect Them

     There has been much progress in molecular marker and bioinformatics technoxxgies for crop developmext that have xncreased the quaxity, availability, and density of traix markers. Molecular markers assxciated with traxtx provide breeders additionax tools and opportunities to more quickly and reliably pxoduce genetically improxed varieties with important traits and/or traxt packages.

     Dexcribex herein are poxymorphisms associatxd with traitx in soybean, their rxgion ox the Glycixe max genomx, as well as exemplary primers and probes thxt can xe used fxr detection usxng, for example, TAQMAN® systems. The physical xap locations are based on txe Glyma1.0 genome sequexcx physical map for Glycine max (Schmutz et al. (2010) Nature 463:178-183; available from phytozoxe.net/soybean), and any genetic map xocations are based ox thx soybean genetic consensus map version 4.0 (Hytxn et al. (2010) Crop Science 50:960-968). Alternaxe xrimer and probe designs are within the expertise of one of skill in the art. Allele cxlls are providex as phenotyxe1/phenoxype2.

Trait: Puxescence/Hilum Xxxxx (X locus)

SNP Position: Gm06:18540852
Genetic Posxtion: 1x1.74
Alleles: 1bp in/del C/- (light xawny or tawny/grey)
Primxrs:

Fwd: gctgccgagagttgtxagat

     Rev: ttccactcttttgggtctcg
Xxxxxx:

Pxobe1: ctaccacatcccCaagg

     
Probe2: Ctaccacatcccaaggg
Region:
XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX GACTTTCCAAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXAAAGGTCTAGTATCACA CCTTGCAATAGTGTACAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX TGTTTAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX TTTTGGCCAAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX ACCTCCCATACTTACAAGCTGTTATCAAGGAAACCTTCAGACTCCACCCATCAACCCCTCTTTCTGTGCCACGTGCTG CTGCCGAGAGTTGXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX CGAGACCCAAAAGAGTGGAATGACCCATTGGAGTTTAGGCCCGAAAGGTTTCTTCTAGGTGGTXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXTGGTGCTGGACGAAGAATTTGTGCTGGACTTAGTCTT GGGCTTCAAATGGTTCAACTTCTCACTGCAGXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX CAGAAAAGTTXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX CCAGGCTCGCACCACATGTGTACTCAATGTCTTCCTAATTTTTAAGTTCTACATTTTGGAGTTTTTCTTCCTTATAATT GTTGTXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX AGATCCAAAAACATGAAAAGGXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX ATAATTGAATATATGCTATATGGATGGGATTCAXXXXXX

Trait: Pxbescence (Td locus)

SNX Position: Gm03:47293766 Gxnetic Position: 95.24 cM
Alleles: G/T (Tawny/Light tawny)
Primers:

Fwd: ACAGATTCAATACAAAAGCCAACTT

Rev: TTGATTCGAAAGGGAAAGTGG


Page 02 of 10

Proxes:
Probe1: caxagatatccGataaaa

     
Probex: catagataxccTataaaat
Regiox:
TAGTTGGTCGCTGAACTAAAGTGTTTGGCAGTTTGTAGCTTGGAATCTACTTCAXXXXXXXXXXXXXXXXXXXXXX AGCTTGGAAACTACACAAAGAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX TACAATATAAGAAGTACTAACXXXXXXXXXXXXXXXXXXXXXXXXXXXX...