Dismiss
InnovationQ will be updated on Sunday, Oct. 22, from 10am ET - noon. You may experience brief service interruptions during that time.
Browse Prior Art Database

The Matrix of life The source of the genetic code for Any Primates Alpha Satellite and Any L1 Transposonal Elements is located in Apis Dorsata Honey Bee. The following Matrix is the core of any primates Alpha Satellite region

IP.com Disclosure Number: IPCOM000249925D
Publication Date: 2017-May-02
Document File: 7 page(s) / 3M

Publishing Venue

The IP.com Prior Art Database

Related People

alex barrak: ATTORNEY

Abstract

On March 2017 we have finally found the Matrix of life The following Matrix is the core of any primates Alpha Satellite region It is also the core of any primate L1 Transposonal element The lines are from "Apis Dorsata" Giant Honey Bee Genome made by "Cold Spring Harbor Laboratory" at 24 sep 2013. It was made as a reference for the European honey bee We are now in the process of getting better reads from PacBio. In the genome, we found 22 reads, totaling 7349 BP Each of the lines is included in parts in other lines. Except from line 4 and 7. Which no one contains any part of them, and they do not contain no one else The Lines can combine in both reverse and direct into one DNA combination. And in general the Matrix seems deterministic and it does not seems to be able to evolve under traditional evolution thinking The Math involved will be discussed more in future publications. Except from the 22 reads, there is additional 23 read attached. This read is the reverse for the matrix, and its vector is designed to separate unity while the Matrix is the core of Unity8

This text was extracted from a PDF file.
This is the abbreviated version, containing approximately 29% of the total text.

April 2, 2017

The Matrix of life

The following Matrix is the core of any primates Alpha Satellite region

It is also the core of any primate L1 Transposonal element

The lines are from “Apis Dorsata” Giant Honey Bee Genome made by “Cold Spring Harbor Laboratory” at

24 sep 2013.

It was made as a reference for the European honey bee

We are now in the process of getting better reads from PacBio.

In the genome, we found 22 reads, totaling 7349 BP

Each of the lines is included in parts in other lines. Except from line 4 and 7. Which no one contains any

part of them, and they do not contain no one else

The Lines can combine in both reverse and direct into one dna combination.

And in general the Matrix seems deterministic and it does not seems to be able to evolve under

traditional evolution thinking

The Math involved will be discussed more in future publications.

--eran Eliyahu tobul

\

The Matrix is as follows:

01.Apis dorsata >CONTIG_42301,THOLEGENOCEGHOTGUNCEQUENCE

AACAGACAAACAGAGAGCCAAATCATGAGTGAACTCCCATTCACAATTGCTTCAAAGAGAATAAAATACCTAGGAATCCAACTTACAAGGGATGTGAAGGACCTCTTCAAGGAGAACTACAAACCACTGCTCAAGGAA

ATAAAAGAGGATACAAACAAATGGAAGAACATTCCATGCTCATGGGTAGGAAGAATCAATATCG

02.Apis dorsata >GI273907.Apis dorsata 1APICDOAGATAUNPLACEDGENOCICGCAFFOLDGCAFFOLD_1181,AHOLEGENOCECHOTGUNCEQUENCE

CTCTCACCACTCCTATTCAACATAGTGTTGGAAGTTCTGGCCAGGGCAATCAGGCAGGAGAAGGAAATAAAGGGTATTCAATTAGGAAAAGAGGAAGTCAAATTGTCCCTGTTTGCAGACGACATGATTGTATATCTAG

AAAACCCCATTGTCTCAGCCCAAAATCTCCTTAAGCTGATAAGCAACTTCAGCAAAGTCTCAGGATACAAAATCAATGTACAAAAATCACAAGCATTCTTATACACCAANNNNNNNNNNNNNNNNNNNNNNNNNGG

TGCTGGGAAAACTGGCTAGCCATATGTAGAAAGCTGAAACTGGATCCCTTCCTTACACCTTATACAAAAATTAATTCAAGATGGATTAAAGACTTAAATGTTAGACCTAAAACCATAAAAACCCTAGAAGAAAACCTAGG

CAATACCATTCAGGACATAGGCATGGGCAAGGACTTCATGTCTAAAACACCAAAAGCAATGGCAACAAAAGCCAAAATTGACAAATGGGATCTAATTAAACTAAAGAGCTTCTGCACAGCAAAAGAAACTACCATCAG

AGTGAACAGGCAACCTACAAAATGGGAGAAAATTTTCGCAACCTACTCATCTGACAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNCATGCACACGTATGTTTATTGCGGCATTATTCACAATAGCAAAGACTTG

GAACCAACCCAAATGTCCAACAATGATAGACTGGATTAAGAAAATGTGGCACATATACACCATGGAATACTATGCAGCCATAAAAAATGATGAGTTCATGTCCTTTGTAGGGACATGGATGAAATTGGAAATCATCATT

CTCAGTAAACTATCGCAAGAACAAAAAACCAA>

03.Apis dorsata >AUPE01042378.Apis dorsata

1APIGDOACATACONTIG_42339,THOLEGENOCEGHOTGUNGEQUENCECGGGATTGTCTTCAGAGAAAATCTAGACAGAAGCATTCTCAGAAACTTCTTTGGGATGTTTGCATTCAAGTCACAGAGTAGAACATTCC

CTTTGGTAGAGCAGGTTTGAAACACTCTTTTTGTAGTATCTGGAAGTGGACATTTGGAGCGCTTTCAGGCCCATGTTGGAAAGGGAAATATCTTCCCGTAACAACTAGGCAGAA>

04.Apis dorsata >AUPE01042577.Apis dorsata

1APIGDOAGATACONTIG_42542,AHOLEGENOCEGHOTGUNCEQUENCEGATCATTAAAAAGTCAGGAAACAACAGGTGCTGGAGAGGATGTGGAGAAATAGGAACACTTTTACACTGTTGGTGGGACTGTAAACT

AGTTCAACCATTGTGGAAGTCAGTGTGGCGATTCCTCAGGGATCTAGAACTAGAAATACCATTTGACCCAGCCATCCCATTACTGGGTATATACCCAAAGGACTATAAATCATGCTGCTATAA>

05.Apis

dorsata >AUPE010429861APICDOACATACONTIG_42953,AHOLEGENOAECHOTGUNCEQUENCECTTTCGGATATTTCCATTCAACTCATAGAGATGAACATGGCCTTTCATAGAGCAGGTTTGAAACACTCTTTTT

GTAGTTTGTGGAAGTGGACATTTCGATCGCCTTGACGCCTACGGTGAAAAAGGAAATATCTTCCCATAAAAAATA...